Застрял без учетной записи администратора на MacBook Air с ОС 10.5.8

Я не уверен, как Google для этой проблемы.

Я недавно обновление операционной системы:X и была авария и я потерял умение делать мой альт4 ярлыка для перемещения пространств. Я вместо того, чтобы получить ¢ характер.

Мой ярлык параметр в настройках:

enter image description here

Я не уверен, где, чтобы переопределить (новых) сочетания клавиш для ¢ ключ. Другие сочетания клавиш для работы (т. е. переключение на рабочий стол 1-3).

Этот работал до сбоя системы.

Я заново добавила моя клавиатура, которую я использую, которая не решает проблему. У меня такая же проблема на моей встроенной клавиатурой, а также моя USB-клавиатура.

+870
Marcus Ahlen 31 мая 2020 г., 04:01:05
20 ответов

Я получил несколько приглашений на конференции по физике. В Австралии, в Японии, во Франции, и другие. Я заканчиваю аспирантуру. Но как я могу принять участие в этих конференциях, если мне нужно 1000 евро для участия в Швеции и мне тоже нужно туда попасть? Есть средства для продвижения?

+957
Sivakumar T 03 февр. '09 в 4:24

Сейчас я испытываю спонтанный сброс среды рабочего стола (при входе в и нормально работает), где экран становится черным, затем снова на экран логина.

  • Сброс кажутся случайными, хотя есть шанс, что это происходит при использовании "Наутилус".
  • Экран становится черным мгновенно, например, есть не что иное, как исчезают Launcher или границы окна.

Где я могу начать поиск причины?

Информация:

  • Я недавно повышен с 11.04 до 11.10, потом 12.04.
  • Используя драйверы NVIDIA "ток" (295.40-0ubuntu1)
+942
Damon McClellan 26 дек. 2013 г., 14:34:50
Другие ответы

Связанные вопросы


Похожие вопросы

Из этого ответа - программных потоков против аппаратных потоков, программного обеспечения потоки потоки, управляемые операционной системы. Но я также узнать другой способ, который называется темы пользователей, которые являются потоки, не потоки ядра, т. е. ОС не знает про эти нитки. Так же темы программы включают в себя пользовательские потоки?

Я не получил никакого ответа из StackOverflow, но я думаю, что идея та же в контексте Линукс, я спрашиваю про термин, используемый в Linux, спасибо.


Для справки, я нашел полезный ресурс на Quora.

+883
Baibav 10 авг. 2015 г., 08:40:12

Это то, что вы ищете:

Есть также некоторые другие возможные решения для ошибка 1601:

+881
talulla 31 мар. 2017 г., 08:26:17

Это, кажется, были очень распространенное упражнение в древних цивилизациях.

Какие группы мышц выиграет от этого? Я бы удивился, если бы это действительно эффективные тренировки, но я не против этого.

+789
user288374 2 мар. 2012 г., 14:59:14

Как эта команда точно работает, шаг за шагом ?

Рекурсивно. РМ не удалить каталог, если его не пустым. По этой причине, это будет первая рекурсия в него, и удалить его содержимое ("обычных" файлов). Это означает, что при этом процесс начинается на самом глубоком уровне в иерархии каталогов, и идет удаление директорий после того, как они были опустошены. Я думаю, вы могли бы поставить его таким образом (хотя возможны незначительные вариации) :

/
---- somedir <-- (5)
-------- а <-- (4)
------------ а <-- (3)
---------------- а <-- (2)
-------------------- somefile1.txt <-- (1)
-------------------- somefile2.txt <-- (1)
-------------------- somefile3.txt <-- (1)
-------------------- [...]
---------------- Б <-- (2)
---------------- [...] <-- (2)
------------ Б <-- (3)
------------ [...] <-- (3)
-------- Б <-- (4)
-------- [...] <-- (4)

 ^ ^ ^ ^ ^
 (5) (4) (3) (2) (1)

Кстати, РМ не имеет вариант, который поможет вам понять, что происходит, как она работает.

-в --подробное
 объяснить, что делается

Я потерял некоторые данные ?

Да (что очень вероятно), в нижней части иерархии каталогов. Удаление файла-это действительно быстро, и, если эти файлы были достаточно маленькими, это не займет много времени для ядра, чтобы избавиться от блоков данных, связанных с каждым из них.

Пойти так далеко, как вы можете в вашем каталоге: файлы, такие как /Дир/А/Е/Г/Р/С/некий-файл (при условии, что сортировка по алфавиту идет так далеко), скорее всего, не будет... конечно, объем данных, которые вы потеряли зависит от того как быстро вы нажмете сочетание клавиш Ctrl + с.

+697
mohammed karam 25 июн. 2018 г., 01:49:50

Откройте терминал и разместить результаты из ifconfig, iwconfig, iwlist Scan и команду lspci | grep в беспроводной здесь... *это должна быть одна команда: "команду lspci | grep в беспроводной" (символ " | "знак клавиши Shift+обратная косая черта) - это список всех PCI устройств, которые имеют строку "беспроводное" на свое имя и/или описание.) Я предполагаю, что ваш WiFi-карта с PCI, а не USB-модем. Вы можете сделать команды dmesg | grep в беспроводные тоже, а вы на него.

Ваш WiFi как сообщается, 0С:00.0 сетевой контроллер: корпорация Broadcom BCM4311 802.11 b/г беспроводной сети (откр. 01) и не сказать, что это было бы прошивки... проблема с Ubuntu должна признать это. Если у вас есть доступ к проводной связи, попробовать настройки системы -> дополнительные драйверы (в 11.10), чтобы проверить, если ваша карта требует проприетарных драйверов. Другая вещь, которую вы, возможно, захотите попробовать для поиска строки 'от Broadcom' в РЕПО (в терминале выполните команду apt-кэша поиск компании Broadcom, или через Синаптик, что может быть проще и посмотреть, если любой пакет соответствует вашей карты и не установлен).

Другая идея состоит в том, чтобы проверить BIOS и/или проверить, что это не отключается - на 620 есть клавиши Fn+не-знаю-что-кнопки не комбинация, которая включает WiFi и выключается (на 610 был уверен). Убедитесь, что он включен и не отключается в BIOS.

Я сделал некоторые погуглить, и придумал какую-то старую информацию - если все остальное терпит неудачу, вы можете попробовать использовать то ndiswrapper. Вот две ссылки для дополнительной информации:

Форум Ubuntu нить

Убунту Вики

Пожалуйста, обратите внимание, что обе эти старые, и, возможно, - и надеюсь - есть родной драйвер для карты. Я, кажется, помню, как работает Ubuntu на 620 без проблем, но я, может быть, смешивая его с чем-то еще.

Решение 11.10

Наконец, вот последняя информация:

Вам нужна прошивка-в43-установщик пакета вместо bcmwl-ядра-источника , что Ubuntu устанавливается. Установить правильный с помощью sudo apt-получить установку прошивки-в43-установщик и удалить неправильный с судо apt-получить продувки bcmwl-ядра-источника (вы можете использовать "удалить" вместо "очистить", это просто моя привычка, чтобы очистить вещи, которые я не использую больше). Вам потребуется рабочее подключение, поэтому постарайтесь сделать кабель для маршрутизатора.

+601
sread 26 янв. 2013 г., 03:24:49

Если вы создали файловую систему на реальных блочных устройств, как она появится у вас, то fdisk не будет вашим другом, пока ваши данные были перемещены в другом месте. Вам придется монтировать файловую систему, скопировать данные, а затем отключите его. Вы можете затем использовать fdisk для того чтобы правильно раздел блочного устройства, использовать mkfs, а на перегородки, смонтировать его и переместить ваши данные:

$ судо -с
# команды mkdir -Р /тугриков/экспорт
# смонтировать /dev/СКБ /тугриков/экспорт
# выход
$ при помощи rsync -а /тугриков/экспорта/ /путь/к/резервное копирование/
$ судо -с
# размонтировать /шоссе/экспорт
# fdisk для устройства /dev/СКБ # создавать свои разделы
# смонтировать /dev/sdb1 /mnt в/экспорта
# выход
$ при помощи rsync -з /путь/к/резервное копирование/ каталог /mnt/экспорт/
+586
Craig Miller 5 нояб. 2018 г., 15:15:27

Я создал рабочий процесс в Automator, состоящие из одного действия, "конвертировать в формат документов Word" (предоставляет слово Microsoft). Я сохранил это в ~/документы/convert_word_to_pdf.приложение. Я могу запустить его, перетащив файл Word за это приложение, и она будет генерировать PDF для меня. Однако, я не могу понять, как запустить его через командную строку. Я попытался запустить автоматизатор convert_word_to_pdf.приложение foo.docx и я не в состоянии открыть рабочий процесс.. Я также попытался convert_word_to_pdf и convert_word_to_pdf/документ.wflow в качестве аргументов автоматизатор, с теми же результатами. Я что-то упускаю?

+580
Jay Mild 2 дек. 2022 г., 08:09:48

Деяния бета-адреноблокаторы, уменьшая частоту сердечных сокращений пациента. Почему это ответ компании на пожилых людей?

+560
pyare lal 12 февр. 2022 г., 15:36:38

Есть ли способ восстановить записанный звуковой файл, когда телефон умер. Когда я заряжать телефон и посмотрел в записи голоса приложение, он показывает запись в списке, но с 00:00 по времени записи. Я не уверен, если аудио-файл все еще где-то на телефоне, и не знаете, как его восстановить

+531
Psclly 15 авг. 2017 г., 23:11:28

Тл;др

пользователь1> СШ пользователя user2@сервер2 '$ОКР'

Длинный ответ

Вы упускаете $ в вашем первом примере запущен SSH команду...если ты действительно типа СШ пользователя user2@сервер2 "ОКР" потом "ОКР" останется литерал, а не расширять в любые переменные окружения.

Если вы хотите пользователь2 , чтобы выполнить команду, используя пользователя2- х переменных окружения, вы должны передать строку, которая, при запуске, будет расширяться в этих переменных. Например:

пользователь1> СШ пользователя user2@сервер2 'Эхо $путь'

Будет Эхо пользователь2путь к терминалу.

Однако, вы также должны знать, что при выполнении команды через SSH, ~/.профиль - это не запустить заранее (см. обсуждение здесь). Поэтому, если вы хотите получить доступ к переменные окружения, определенные в ~/.профиль, выполните это:

пользователь1> СШ пользователя user2@сервер2 'источник ~/.профиль; $ОКР'

Предупреждение: Если вы используете двойные кавычки (") вместо кавычек ('), тогда оболочка запущена от имени user1 будет расширять любой среде переменные внутри двойных кавычек, чтобы пользователь user1с переменными окружения , прежде чем команда когда-либо отправляется по SSH для пользователя user2.

+501
Jorg Jansen 30 сент. 2015 г., 23:18:21
Онлайн-сервис и сообщество (couchsurfing.com) основан на хозяев, предлагающих свои диван для посетителей (т. е. туристов), чтобы использовать в качестве кровати. Похожие на гостеприимство клуба или GlobalFreeloaders.
+467
Mirjam 10 янв. 2013 г., 14:50:00

Этикет не должен сильно отличаться, если вообще, между городами. Но вот лишь краткий перечень для вас.

Обязательно нужно соблюдать правила. Большинство конвенций имеют набор правил на своих сайтах, чаще даже несколько. Возьмем, например, голландский Анимаккорд, который имеет общие правила и запись/фотография правила. Большинство из них обновляются каждый год, поэтому обязательно перечитайте их, прежде чем вы снова посетите.

Некоторые специальные мероприятия, такие как концерты, возможно, также есть специальный набор правил. Эти часто можно найти на сайте мероприятия, или будет сказано в начале такое шоу.

Помимо этих, есть некоторые хорошие практики:

  • Не фотографировать косплееров, не спрашивая.

Они стараются выглядеть и вести себя как их характер, и часто имеют специальные позы, которые делают их персонажи выглядят лучше/более привлекательным. Фотографировать без спроса могут раздражать, а иногда даже злости. Поэтому обязательно спросите их, если это первый ОК!

В некоторых случаях, например, если вы попросили, то вы могли быть переданы реквизит чувствовать. Реквизит может выглядеть как крепкие широкие мечи, но часто не ходим. Будьте нежны и осторожны, они вложили много времени в этих вещах

  • Бесплатные объятия знаки не равны бесплатный нащупать признаки.

Часто вы увидите парней и девушек, ходить с "бесплатно обнять". Когда обнимает говорит человек, держи руки. Приклада не сдавливает, не шарит. (Да, такое бывает.) Также обязательно нужно показать свое намерение, чтобы обнять их! Обнимать их без них ожидал, что он может закончиться болезненно для вас.

  • Не случайно обнять, схватить, или прикасаться к людям.

Хотя это часто считается нормальной практикой, в минусы это как-то вроде бы довольно часто забывают. Просто не делай этого, держать его интересным для всех.

  • Не будьте слишком настойчивы.

Если человек сказал тебе отвали, отвали. Вы можете быть очень восторженным и счастливым, но некоторым людям может не понравиться такое поведение. И если они говорят вам так, просто остановить.

  • Уверены? Спросите сначала!

Если по каким-то причинам вы не уверены в правила или поведение, вы всегда можете задать основании Конвенции об этом по электронной почте. Или раз на сайте, вы всегда можете обратиться к сотрудникам/ "шестерок" сказал Кон.

Кроме того, вы можете свободно наслаждаться конвенций, как вы хотите. Нет необходимости в лицах покер, но, будучи слишком взволнован, может быть также потрудились люди. Просто стараюсь поддерживать какой-то здравый смысл во все волнение.

+409
Fitrah 30 июл. 2010 г., 23:05:08

Я недавно купил Оппо A3s, который смартфон с 2 ГБ ОЗУ и 16 ГБ ПЗУ, но я получаю только 8 ГБ доступного пространства, с которого Андроид, используя 2 ГБ. Что мне теперь делать?

+401
Waquo 13 апр. 2014 г., 23:52:57

У меня два fasta файлы, как показано ниже,

Файл:1

>Contig_1:90600-91187 
AAGGCCATCAAGGACGTGGATGAGGTCGTCAAGGGCAAGGAACAGGAATTGATGACGGTC

>Contig_98:35323-35886
GACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCCTGGATCTGGTCGAAATCCAGCCGCAG 

>Contig_24:26615-28387
GCTGCGGCGCTGATCCTGGCGGCCCGCGCCGAGGAGATCGCCCGTTTGGAGCGCGGCGAA

Файл2

>Contig_1:90600-91187
GACCGTCATCAATTCCTGTTCCTTGCCCTTGACGACCTCATCCACGTCCTTGATGGCCTT 

>Contig_24:26615-28387
TTCGCCGCGCTCCAAACGGGCGATCTCCTCGGCGCGGGCCGCCAGGATCAGCGCCG

Оба файла имеют одинаковые заголовки Фаста, но в различной их последовательности. Мне нужно заменить файл:2 последовательности в файле:1, как показано ниже,

Ожидаемые результаты:

>Contig_1:90600-91187
GACCGTCATCAATTCCTGTTCCTTGCCCTTGACGACCTCATCCACGTCCTTGATGGCCTT 

>Contig_98:35323-35886
GACGAAGCGCTCGCCAAGGCCGAAGAAGAAGGCCTGGATCTGGTCGAAATCCAGCCG 

>Contig_24:26615-28387
TTCGCCGCGCTCCAAACGGGCGATCTCCTCGGCGCGGGCCGCCAGGATCAGCGCCG

Я попытался с кошкой команду, но это обьединении всех последовательностей. Но, мне нужно заменить Файл1 Файл2 последовательностей с последовательностями.

+337
ArcticSummer 19 июн. 2016 г., 11:58:53

Попробуйте:

Баш-с "Эхо \'"

или

Баш-с "Эхо \"'\""

Сочетая его:

$ Баш-с 'Эхо "\"\\"'"\'"
"\'
+331
roy dunn 12 февр. 2015 г., 08:50:44

Я пробовал каждый корка пирога, который выходит в кулинарные журналы и книги на протяжении многих лет. Один раз я использовал один из Марты Стюарт' (у нее много и они не все одинаковы), что добавила яйцо....этот пирог стал звездой вечера и действительно самый вкусный пирог, который я когда-либо делал.

Я узнал, что добавление яиц-это французский способ и тесто называется десертах на основе pâte à оригинальных (буквально "тесто для затемнения") - это вызывает чуть лучше цвета и браунинг, и это добавляет богатство вкуса в жиры ига яйцо.

И честно говоря - это было еще лучше нежное ощущение во рту - это "разогнали" более легко во рту. Видимо это как-то связано с предотвращением формирования клейковины, но также добавляет цвет и текстура получше в тесто.

+303
godguy 5 февр. 2022 г., 04:59:39

У меня есть файл сетевого журнала как этот:

Nmap в отчете о сканировании для 192.168.1.51
Хоста.
ГОСУДАРСТВЕННОГО ПОРТОВОГО ОБСЛУЖИВАНИЯ
80/TCP и откройте http
443/TCP в открытии https
8080/TCP на открытые HTTP-прокси
443/TCP в открытии https
8080/TCP на открытые HTTP-прокси
8082/ТСР отфильтрованы носильщик
8083/ТСР отфильтрованы по HTTPS-АЛТ

Nmap в отчете о сканировании для 192.168.1.201
Хоста.
ГОСУДАРСТВЕННОГО ПОРТОВОГО ОБСЛУЖИВАНИЯ
80/TCP и откройте http
443/TCP в отфильтрованы по протоколу HTTPS
8281/TCP и фильтруют HTTP-прокси
8080/открытые седан ПТС 
8801/протокол TCP отфильтрованы по HTTPS-АЛТ

Nmap в отчете о сканировании для 192.168.1.17
Хоста.
ГОСУДАРСТВЕННОГО ПОРТОВОГО ОБСЛУЖИВАНИЯ
80/TCP в закрытых http
443/TCP закрыто по протоколу HTTPS
9081/TCP для открытых ecan

Nmap в отчете о сканировании на 192.168.1.10
Хоста.
ГОСУДАРСТВЕННОГО ПОРТОВОГО ОБСЛУЖИВАНИЯ
80/TCP закрыто фтп
443/TCP в открытии https
9081/открыть стандартный TCP 

Я хочу, чтобы извлечь IP-адресов и количество открытых портов для каждого IP-адреса, так что в результате:

192.168.1.10 - 2
192.168.1.201 - 2
192.168.1.51 - 5
192.168.1.17 - 1
+266
Popex 9 апр. 2022 г., 02:02:25

Это возможно для awk, чтобы прочитать программу и входные данные со стандартного ввод?

Я хотел бы быть в состоянии передать файл следующую функцию.

process_data () {
 на awk -е - <<ВФ
{печать}
ВФ
}

Примечание: фактическая программа больше, он не может быть передан в командной строке аргумент, и я бы предпочел не использовать временные файлы.

В настоящее время он ничего не выводит.

$ да | начальник | process_data 
$ 
+75
Michael Deardeuff 13 окт. 2014 г., 20:41:07

Показать вопросы с тегом