по rsync скрипт "не удается стать"

После обновления Windows до версии 10, мой ноутбук начинает прямо в режиме восстановления. Вы можете найти Мои настройки ниже :

Диск 1 (1и) : где /Home /подкачки устанавливается совместно с Windows для данных и кэш папку
1 ССД (120Go) : где / устанавливается как Windows, установленной

Что важно : утилита GParted покажите мне 30GiB незанятое на SSD и я подозреваю, что это мои Федора (я не помню точно, сколько я положил его в).

Вещи, которые я пробовал, без успеха :

  • загрузки-ремонт через лайв Убунту (если это может помочь : доклад)
  • Эта техника. Это нормально, потому что я не нахожу папки /Boot где-либо.
  • Используя testdisk для анализа SSD дисков для того, чтобы восстановить возможные потери / разделе (незанятое перегородки показали в программу GParted) -конечно, я побежал загрузки-ремонт впоследствии. Чтобы быть точным, я анализирую диск, а потом писать, как я читал на нескольких документах.

Любая помощь приветствуется.

Редактировать :

судо и fdisk -л на Pastebin

$ судо lsblk

МАЙОР ИМЯ:MIN РАЗМЕР РМ РО МОНТИРОВАНИЯ ТИП 
ПДД 8:0 0 111.8 г 0 диск 
├─sda1, поскольку 8:1 0 0 350М часть /СМИ/Убунту/Réservé ас системы
├─sda2 8:2 0 81.7 г 0 часть /СМИ/Убунту/D8C820EDC820CB96
└─sda3 в качестве 8:3 0 0 450М часть /СМИ/Убунту/4C343C29343C1882
в SDB 8:16 0 931.5 г 0 диск 
├─sdb1 8:17 0 902.2 г 0 часть /СМИ/Убунту/данные
├─sdb2 буд ет экспортироваться 8:18 0 28,3 г 0 часть /тугриков
└─sdb3 8:19 0 0 1000м часть [своп]
и SDC 8:32 1 30г 0 диск 
└─sdc1 8:33 1 30г 0 часть /компакт-диск
loop0 7:0 0 1,4 г 1 цикл /rofs
+143
semtex41 20 мая 2014 г., 16:42:39
23 ответов

Итак, первая проблема я бегу в загрузке с Live-образа. Но после погуглить много я мог бы кое-что выяснить и теперь я загрузке, как следующие:

драйверы=несвободных

и добавления

systemd не.маска=mhwd-жить.услуги

для параметров загрузки.

После этого можно загрузиться в Live-образа.

Но если я пытаюсь установить его, он бы застрял. Так редактировать /usr/lib/calamares/modules/mhwdcfg/main.py

От:

деф запустить(самовыдвижение):
 для B в себя.автобус:
 для удостоверения личности.идентификатор['чистая']:
 самовывоз.настроить(б, ИД)
 для удостоверения личности.идентификатор['видео']:
 самовывоз.настроить(б, ИД)

 возврата нет

К:

деф запустить(самовыдвижение):
 возврата нет

После этого я могу установить его с следовать этому способствуют

диск 1: SSD-накопитель /разработки/nvme0n1p3 в файл /boot/efi с FAT32 и 250мб
/разработки/nvme0n1p1 в /своп с linuxswap и 8GiB
/разработки/nvme0n1p2 в / с ext4 и 111GiB
диск 2: Жесткий диск на /dev/sda1, поскольку в /Home в NTFS и 931.5 Гб у меня были некоторые ошибки с ext4...


Так что теперь он установлен.

После первого запуска я делаю обновления:

судо Пакман -Syyu

после этого я перезагрузка, а иногда он застрянет, но начинается после жесткого выключения питания.

Далее я попытался установить Шмель без удачи, и мне пришлось повторить...

Так что я попробовал добавил это, но я думаю, что это не требуется в Моя новая установка я не использую его. /и т. д./По умолчанию/жратва:

acpi_osi=! acpi_osi='окон 2009' 

чем я сделал:

обновление-жратва судо 

и перезагрузка

чем я попробую так установить двойные графические драйверы и с чем его едят

команду sudo mhwd -PCI с несвободной 0300

Но я застрял на установке драйверов от Nvidia Шмель...
Каждый раз, когда я установить их независимо от того, что я застрял на полный черный экран после перезагрузки, и я не могу войти с помощью Alt+Ctrl+клавиша Ф1 ...

С бесплатные драйвера он работает, вероятно, но с очень плохим исполнением.

Я попробовал еще одну вещь, которая подробно описала здесь: методические указания-настройка-Прайм-с-с NVIDIA

Но после того как я сделал все, я снова застрял на черном экране, но на этот раз я могу получить доступ к разным терминалам с помощью сочетания клавиш Ctrl+АЛТ+Ф2 ...

+995
blanco 03 февр. '09 в 4:24

Три или четыре раза у меня были чашки принтера, управляемого бросить, с "ожидании" или других подобных проблем, и я никогда не починил принтер, пока я не установил новый Линукс. Я не глуп, но это заставляет меня чувствовать себя глупо, что я не могу понять, как в аду, чтобы исправить чашек сразу пошло не так. Я хочу что-то другое или есть кубки гении, черт возьми, рассказать вам, как сбросить эту чертову штуку.

+983
Ligerien 7 окт. 2013 г., 18:39:02
Другие ответы

Связанные вопросы


Похожие вопросы

Я купил сервер/капли на цифровом океане и в своих рекомендациях отключен пароль для входа в систему, поэтому она может быть доступна только по SSH ключ.

Я понимаю механизм СШ безопасности в основном делает, так это можно только на компьютере с определенным секретным ключом хранится.

Что произойдет, если мой компьютер сломается? Я должен резервное копирование файлов по SSH? Это было бы недоступным навсегда? Как я должен обеспечить безопасность своего сервера, а сделать я не могу случайно удалить все доступ к нему?

+853
Alex Under 12 дек. 2014 г., 16:58:39

Сангха означает разные вещи для разных людей.

Некоторые люди, которые "принимают прибежище в Сангхе" имеют в виду всех просветленных существ, которые когда-либо жили и их убежище находится в вдохновившись примером такого существа.

Некоторые из них, ссылаясь на сообщества посвященные монахи и монахини, и они выглядят в монашеской общине на учения Дхаммы и руководство в своей практике.

Некоторые имеют в виду всех последователей учения Будды не только просвещенный и рукоположенный из них. Это больше "попутчиков по пути" концепции.

Из Википедии: "некоторые ученые отмечают, что Сангха-это часто (и по их словам, ошибочно) используется на Западе для обозначения какой-либо буддийской общины." Дело в том, нет ни одной конкретной вещи, что понимается в Санга, который находит прибежище в.

Чтобы действительно ответить на ваш вопрос, мы должны знать, что вы подразумеваете под Санга. Но из контекста вашего вопроса, я предполагаю, что вы имеете в виду сообщество, вращаясь вокруг буддизма, где можно учиться и общаться с другими.

Вот что я хотел бы думать, что мы практикуем здесь о буддизме.ЮВ. Это из Маха-parinibbana Сутта: последние дни Будды:

  1. "Тогда, Ананда, я ответила Мара, зло, говоря: 'я не пришел на мой окончательный уход от лукавого, пока мои монахи и bhikkhunis, мирян и мирянок, пришел, чтобы быть истинными учениками — мудрые, воспитанные, APT и узнал, хранители Дхармы, живущих согласно Дхамме, соблюдения соответствующего поведения и, узнав хозяина слово, умеют излагать его, проповедовать его, возвещать его, установить его, раскрыть его, объяснять подробно, и было понятно; когда возникают негативные мнения, они должны уметь тщательно и хорошо их опровергнуть, и проповедовать это убедительно и раскрепощает Дхаммы.

Это великая и замечательная вещь, что у нас есть формат, чтобы попробовать наши силы на разъяснение Дхаммы кому-то другому. Это отличная возможность и глубокую ответственность за то, чтобы попробовать наше самое лучшее, чтобы получить это право. Это хорошее место. :)

Но, что сказал, Я не думаю, что это разумно, чтобы в полной мере почувствовать, что кто-то принимает прибежище здесь, как и в Сангхе и в значительной степени в зависимости от его для обучения. Есть много потенциальных недостатков. Это очень демократично и, что иногда может привести к необоснованным ответы получают голоса. Мы приветствуем всех традиций, но это может привести к такой смеси взгляды выразил это может ввести в заблуждение новичков в буддизме. Это ответ на вопрос о преимуществах придерживаться одной традиции-это хорошее объяснение того, к чему я клоню.

Как велика, как на сайте, это не сплошной суррогат для обучения с преподавателем или в центре или в определенным образом структурированной программы. Это не то же самое, как ходить в физическое место и чувствуя тихое, спокойное и душевное пространство, предназначенное для медитации, даже если вам приходится преодолевать большие расстояния, иногда за этот опыт. Это отличная бесплатная практика, но структурированные познания и медитации (будь то местные или онлайн) в конкретной традиции могут предложить всю глубину учения и поддержки для вашей конкретной практикой, которые не могут быть предложены в короткий ответ, Демократической, вопросы и ответы формат сообщества.

+832
Mort Schumacher 12 мар. 2013 г., 00:49:29

IAM новый на Linux / Debian с

Я пытаюсь настроить FTP-сервер в использование Debian службу proftpd.

Я установил пакет пользователя создается при установке я поставил пароль для этого пользователя и он работает нормально. Им пытаются пусть местные пользователи с локальных паролей на сервере иметь доступ к FTP, но без удачи так далеко, что я должен сделать, чтобы разрешить определенной группе, чтобы иметь доступ к FTP. Затем я попытался с помощью SFTP, работает для пользователя root, но не для любого другого локального пользователя

Я тоже пытаюсь открыть определенный каталог в веб-браузере, используя http:/ipaddress/directoryneeded но он говорит мне, что запрещено, так еще и без удачи

Я ценю вашу помощь и готова к любой детали нужно от меня

+827
Jeroen Hegeman 31 янв. 2014 г., 14:29:54

Компания VMware Fusion 6 В работает безупречно для меня, на середине 2011 ПМБ, работающих под управлением Mac ОС Х 10.8.5

Я запустить Windows XP, 7 и 8 гостей без каких-либо проблем.

+776
amess 3 июл. 2011 г., 08:53:47

Есть пакет linux, который может выводить любой текст, переданный ему в большем размере, по сути, не меняя размер шрифта в терминале. В основном ищу что-то подобное;

$ echobig "привет!"
 _ _ _ _ _ 
| | (_) | | | | | |
| |__ _ | |_| |__ ___ _ __ ___| |
| '_ \| | | __| '_ \ / _ \ '__/ _ \ |
| | | | | | |_| | | | __/ | | __/_|
|_| |_|_| \__|_| |_|\___|_| \___(_)

Вероятно, принимая аргументы как горизонтальной и вертикальной ширины для персонажей, чтобы быть вокруг.

Редактировать: я ищу программу, которая принимает текст, и печатает их. Изображения в ASCII не 'преобразователи'.

+767
user29103 1 дек. 2012 г., 05:30:15

У меня есть 13” Макбук Про середины 2014 года, а также поздней модели MacBook Pro 2011 года.

Мой экран Макбука 2014 про разбито и я был интересно, если я мог бы заменить его с моим MacBook Pro 2011 года.

Будут ли проблемы при установке?

+756
tommidodd 28 янв. 2010 г., 02:10:01

В конце главы 19 Синдо, Кадзуо на станции кикуна играет на фортепиано для Кодзуэ Айхара, его фортепианной студии одноклассник, после их даты. Ута Нарусэ слушает, как она проходит мимо дома Кадзуо, и в двух из панелей, она рисуется на фоне заметно отличается художественный стиль:

first panel

second panel

Вторая группа явно содержит ссылку на Густава Климта "Поцелуй". С учетом этого, первая группа также ссылку на произведение искусства? Я пытался смотреть на некоторые другие картины Климта искать похожие изображения, но я не нашел ничего слишком убедительными, возможно, отчасти потому, что у меня нет сильных визуальных искусств почву.

+619
Gianolepo 28 мая 2016 г., 09:15:58

Совместить (объединить) два файлы, использовать кота:

команды $ cat файл1 файл2 >файл file3

Это также работает для файлов, сжатых с помощью gzip, командой bzip2 и XZ может (и, возможно, других) из-за тем, как эти форматы сжатия, являются структурированными.

Например, скажем, у меня есть два сжатых файлов в формате fasta (или любые два сжатых файлов, которые я хочу объединить):

$ gzcat file1.fa.gz
>seq1
ACTACTACTACTACTACTACTACTACT

$ gzcat file2.fa.gz
>seq1
GATAGATAGATAGATAGATAGATAGATAAAAAAAA

Я совмещаю их, без декомпрессии или повторного сжатия:

$ кот file1.fa.gz file2.fa.gz >file3.fa.gz

Результатом является комбинированным и сжатый файл:

$ gzcat file3.fa.gz
>seq1
ACTACTACTACTACTACTACTACTACT
>seq1
GATAGATAGATAGATAGATAGATAGATAAAAAAAA

Обратите внимание, что если это дает вам данные, которые как-то неправильно, то ошибка, скорее всего, также присутствует в одной (или обеих) из ваших исходных файлов.

+571
nurkka 11 февр. 2013 г., 04:16:38

Я скачиваю с ktorrent и заметил, что, когда я выберите "выделить места на диске перед началом торрент", он создает все файлы при запуске, предположительно пустой, чтобы избежать фрагментации.

Когда я в эту папку и использовать ЛС, он показывает размеры, а также общий размер и эти два не складываются. ДФ также передает только реально используемое пространство.

ЛС-ЛГ

общая 745M
-RW-р-р-- 1 ##### ##### 542M 8 фев 15:55 Звездный путь - 1x01 - клетка.Ави
-RW-р-р-- 1 ##### ##### 351 млн 8 фев 14:37 Звездный путь - 1x02 - где не ступала нога человека.Ави
-RW-р-р-- 1 ##### ##### 346M 8 фев 16:04 Звездный путь - 1x03 - в Corbomite маневр.Ави
-RW-р-р-- 1 ##### ##### 350М февраля 8 16:02 Звездный путь - 1x04 - Мадд женщины.Ави
-RW-р-р-- 1 ##### ##### 350М февраля 8 15:35 Звездный путь - 1x05 - Враг внутри.Ави
-RW-р-р-- 1 ##### ##### 350М 8 фев 15:37 Звездный путь - 1x06 - мужчина, ловушка.Ави
... (многое другое)

Однако с вариант, я получаю реальные размеры:

ЛС-ы

общая 728M
 0 Звездный путь - 1x01 - клетка.Ави
351 млн Звездный путь - 1x02 - где не ступала нога человека.Ави
 42М Звездный путь - 1x03 - в Corbomite маневр.Ави
195м Звездный путь - 1x04 - женщины Мадда по.Ави
5.8 м Звездный путь - 1x05 - Враг внутри.Ави
9,7 м Звездный путь - 1x06 - мужчина, ловушка.Ави
.... (размер соответствует)

Как это возможно? Есть некоторые "размер файла" в настройках файловой системы (ext4 разделов), что ЛС читает (иногда) и ДФ игнорирует?

+561
Ben Rozen 2 мая 2021 г., 00:57:48

Просто сделать все 30 секунд на спринтерской скорости и целых 30 секунд на скорости ходьбы. Он все равно будет считаться HIIT тренировки.

+498
Silicium14 20 дек. 2017 г., 14:23:23

У меня есть внешний диск с двумя разделами на нем, что я подключен в моем MacBook Pro, когда я нахожусь на моем столе. (Одна для Машины времени, другие просто для дополнительного хранения.) Иногда мне нужно, чтобы захватить мой ноутбук быстро и взять его где-то, но я должен изменить, чтобы место, где я могу видеть разделы на рабочем столе, их лассо, два пальца нажмите, и выберите "извлечь". Есть ли более быстрый способ под Маверикс, или я должен создать сценарий AppleScript, как это одно с помощью сочетания клавиш?

Примечание: Я не ищу, чтобы извлечь эти только тогда, когда я положил мой Mac в режим сна (как изучить здесь). Иногда я на экране-обмен в Казахстане и у меня Мак отошел от стола на минуту, если вы понимаете о чем я :-).

+481
TavrCrimea 18 дек. 2015 г., 01:11:47

Мой вес составляет 52 кг , а высота составляет 5 футов 5 дюймов.

Я начал упражнения, как прыжки через скакалку, быстрая ходьба. Я не желаю, чтобы похудеть.

Каким должен быть мой ежедневный рацион для того же?
Когда вы говорите, едите много белков и калорий, я не понимаю, насколько это мало.

Ответы со ссылками будут оценены.

+472
anith encer 24 мая 2022 г., 17:44:39

Примерно через месяц, я буду летать с лотом, передачи в варшавском аэропорту Шопена. У меня есть 1 час и 5 минут, если полет по времени. В последний раз я летала с ними (Тбилиси-Варшава-Лондон Хитроу), у меня было 1 час и 10 минут, но рейс Тбилиси был отложен почти на 2 часа, так что я в конечном итоге потери соединения. К счастью, там был другой рейс из Варшавы в Лондон в тот же день, но в итоге я приехав в Лондон около 6 вечера вместо ожидаемых 9 утра.

На этот раз я летел в Тбилиси, и если я скучаю по моей связи, следующий рейс через 24 часа.

Испытав однажды передачу, я обеспокоен тем, что за 1 час может не хватить. По прибытии, я, вероятно, будет на автобусе до терминала, потом пройти паспортный контроль и сканирование личной безопасности. В прошлый раз, с того момента, как они открыли двери самолета, чтобы когда я приехал к трансферной стойке, потребовалось почти 40 минут.

Любые предложения, чтобы минимизировать риск отсутствует стыковочный рейс Варшава аэропорт Шопена?

+468
user218719 21 дек. 2012 г., 16:34:09

у меня Асер икстенса ноутбук 5620z и после установки 12.04 я заметил, что он не распознает чипсет это WiFi (Intel® для беспроводного соединения WiFi 4965AGN) . Нужно ли устанавливать дополнительные драйверы ? если да, то где я могу их найти ?

+448
Arjuna 15 9 июл. 2023 г., 21:55:19

ЗШ

для обратного клавиши <=> значения

В ЗШ, где основной синтаксис для определения хэш-это хэш=(К1 К2 В1 В2...) , как в языке Perl (новые версии также поддерживают неловко ksh93/Баш синтаксис для совместимости, хотя и с вариациями, когда дело доходит до цитирования ключи)

ключи=("${(@к)хэш}")
значения=("${(@в)хэш}")

верстал -обратная
обратная=("${(@)ценности: ключи^}") # выбора оператора сжать 

или с помощью цикла:

для K в ("${(@КВ}хэш}") отменил[$в]=$к

В @ и двойные кавычки, чтобы сохранить пустые ключи и значения (обратите внимание, что баш ассоциативные массивы не поддерживает пустые ключи). Как экспансия элементов в ассоциативных массивах в частности, нет порядка, если несколько элементов $хэш имеют одинаковое значение (которое будет в конечном итоге ключевым в $отменено), вы не можете сказать, какой ключ будет использоваться в качестве значения в $отменено.

для вашего цикла

Вы бы использовать Р хэш-подстрочный флаг, чтобы получить элементы, основанные на значение вместо ключ, в сочетании с электронной для точного (а не по шаблону) матч, а потом получить ключи для этих элементов с к параметра развертывания флага:

для value ("${(@у)хэш}")
 принт-Р "элементов с 'значение $' в качестве параметра: ${(@к)хэш - [(Ре) значение$value]}"

ваш подход в Perl

ЗШ (вопреки ksh93) не поддерживает многомерные массивы, но ее переменные могут содержать нулевой байт, так что ты можешь использовать это, чтобы отделить элементы, если элементы не иначе содержать нулевой байт, или использовать ${(Щ)ВАР} / ${(Щ)${(з)вар}} для кодирования/декодирования в список через цитирование.

верстаю видел
для K в ("${(@КВ)хэш}")
 видел[$в]+=" ${(щ)к}"

для K в ("${(@КВ)видел}")
 принт-Р "элементов с '$K в качестве параметра: ${(Д@)${(з)с V}}"

ksh93

ksh93 был первый снаряд ввести ассоциативные массивы в 1993 году. Синтаксис для присвоения значений в целом означает, что это очень трудно сделать это программно вопреки ЗШ, но по крайней мере это несколько оправдано в ksh93 в ksh93 поддерживает сложные вложенные структуры данных.

В частности, здесь ksh93 поддерживает массивы в качестве значений хэш-элементы, так что вы можете сделать:

верстаю видел
для K в "${!хэш[@]}"; сделать
видел[${хеш[$к]}]+=("$к")
сделано

для K в "${!видел[@]}"; сделать
 принт-Р "элементов с '$к', так как значение ${х [к][@]}"
сделано

Баш

Баш добавлена поддержка ассоциативных массивов десятилетия спустя, скопировал ksh93 синтаксис, но не в других развитых структур данных, и не имеет каких-либо дополнительных параметра расширения операторов ЗШ.

В Баш, вы могли бы использовать в котировальный список подход упоминается в ЗШ с помощью функции printf %м или с более новыми версиями ${ВАР@Д}.

верстаю видел
для K в "${!хэш[@]}"; сделать
 е -в quoted_k %к "$к"
 видел[${хеш[$к]}]+=" $quoted_k"
сделано

для K в "${!видел[@]}"; сделать
 ивала "элементов=(${видели [в$K]})"
 Эхо -Э "элементы с '$K в качестве параметра: ${элементы[@]}"
сделано

Как отмечалось ранее, тем не менее, Баш ассоциативные массивы не поддерживают пустое значение в качестве ключа, поэтому он не будет работать, если некоторые из $хэш -значения будут пустыми. Вы можете выбрать, чтобы заменить пустую строку в какое-то место держатель, как <пусто> или префикс ключа с каким-то персонажем, что бы вы потом полосы на дисплее.

+250
Lawrence Wilson 6 дек. 2020 г., 06:33:28

Как сказано в комментарии, для получения индийской электронной визы нужны две чистые страницы, но они не должны быть рядом друг с другом.

Одна страница будет использоваться для самой визы, а другая будет использоваться для въездного штампа. Как вы уже четыре страницы слева это будет хорошо.

+243
user25626 28 нояб. 2010 г., 12:37:32

Также может быть, что вы пытаетесь войти в систему как root, и он выключен по умолчанию, если так использовать ваш обычный пользователь

  • это в ответ на ваши проблемы СШ
+238
JulianS 28 июл. 2011 г., 13:29:25

enter image description here

Мой нефритовый завод имеет эти белые пушистые шарики, формируя на ее корни. Не уверен, если это какой-то типа плесени или яйца насекомых?

Я в настоящее время не используют никаких пестицидов на растения... может кто-нибудь посоветовать, как лучше избавиться от этих белых шариков?

Это произошло несколько месяцев назад и я отрезать все корни, которые, казалось бы, это мелочи на них (остался почти без корней), но они, кажется, так не должно быть, избавились бы она ни была.

Обновление: я удалил всю почву с корней и опрыскал их изопропанол спирт. Пальцы скрещенными они остаются чистыми![jade plant roots]1

+182
Catalog 23 янв. 2011 г., 02:03:48

Если я правильно понял ваш пример команды, это должно работать:

SSH пользователь@хост 'Эхо "введите что-то:" читай, ВАР; Эхо "получил так: $var"' 

Это работало, когда "хозяин" был для Slackware Linux сервер, и СШ побежал по дуге Linux на ноутбук. Моя раковина на Инсталяционный сервер ЗШ 4.2.6 (i486-Slackware как-Линукс-гну). Поскольку чтение - это раковины встроенные, я думаю, что выбор раковины может иметь что-то с этим делать.

+70
BiggerSnuff 24 июн. 2020 г., 06:54:05
  • счетчик ваших данных скорее всего виджет суммированных точное количество переданных данных. т. е. для перевода из 33 КБ, и еще 17 КБ, он будет считать 33+17 = 50 кб
  • ваш оператор скорее всего резюмирует блоков 10 кб. Поэтому, учитывая тот же пример, он вычисляет 40+20 = 60 КБ
  • не по-настоящему, но, похоже, внутренние Андроида забирает обе и дает в среднем, поэтому для нашего примера он будет придумывать 55 КБ. Не имеет абсолютно никакого смысла (и я сомневаюсь, что это правда), но rawly соответствует номерам, указанным в вашем вопросе...
+39
TiaBee 11 нояб. 2011 г., 00:43:13

Кажется, в основном безопасным. Как правило, достаточно 3 часов. Несколько месяцев назад у нас была проблема с Пакистаном, поэтому большинство авиакомпаний не должно полета над ним. Ото я предполагаю, что самолет будет рейсы Муш больше на север.

В любом случае, от Flightradar24 полета CA950, часто на время. Несколько раз чуть меньше 1 часа (и два раза в 1 ч 30 мин задержки). Поэтому она должна быть осуществима.

Но в пути непредвиденные обстоятельства, поэтому стараюсь думать план " Б " (у них есть поздний рейс в Японию? Подготовить альтернативный вариант: это просто для обсуждения, если у вас есть уже некоторые идеи). Вам на вашу ручную кладь и вещи на одну дополнительную ночь (и день).

+13
Nijat2018 26 янв. 2010 г., 04:25:07

Показать вопросы с тегом